I have touched on a few areas in the book which were largely intended to provoke thought on those particular subjects. I do not claim here that I have empirically proved each point but I do wish to emphasize again the essence of the book. The overall theme has been that the atheist does not hold a tenable position either scientifically or logically. His conclusion that there is no God is in absurd defiance of known reality. Now let’s spell out the main points again very clearly so that no one can honestly pretend to have refuted them while simply diverting our attention to the peripheral points that I made along the way.
The foundation of all life is contained in specific detailed instructions and information that can be read, interpreted, understood and acted upon logically. This type of information cannot arise without intelligent input. Let’s spell out the problem and the proposed solution so that the skeptic can experiment on his own to prove me wrong. DNA and/or RNA gives specific instructions that are in some ways similar to the instructions that a worker might follow as he builds and operates a machine. I will write some instructions which are similar to a fraction of one percent of the instructions contained in a simple, single celled organism and then I will present the problem.
“The completed organism is to be simply one cell. First assemble the RNA molecule so that the ribosomes can interpret the completed instructions. Next begin making the various amino acids. Then arrange them in such a way that they form useful proteins. After those steps are completed then devise a system whereby the RNA can cut itself into pieces. Devise a means whereby these pieces only use the specific information that is needed at a particular time. Now take those pieces of information and splice them together at various times as needed within the cell. Devise a way whereby the ribosomes can come into existence to process the information that is initially necessary for their existence. Finally, cause all of the appropriate parts of the cell to form themselves and replicate themselves in an orderly fashion so that the initial life is able to make and maintain the parts that are necessary to make and maintain and regulate the parts necessary to make the initial parts and the associated machinery that is necessary to make the parts initially out of parts that the initial machines make.”
Now here is the problem. Use any system that you choose, whether it is monkeys typing randomly on billions of typewriters for billions of years, or powerful computers or whatever you want, and produce the above paragraph without intelligent input. Of course a human being will be allowed to set up the experiment but he may not intervene once it is underway. If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. The alphabet should be randomly entered into the program along with punctuation marks and spaces but we must stop there as further interference would make the results of our experiment useless in solving the problem. Now run this random program as long as you want on as many computers as you choose and see if the result is ever the above paragraph. Be sure to keep accurate records of each step of the program that you devise so that it can be readily duplicated and tested. That way the public will not be tricked again by intelligent input under the guise of natural processes. After you have solved the problem return to this book and read the following paragraph. NOT NOW!! YOU HAVEN’T SOLVED THE FIRST PROBLEM YET!!
Okay good. Now make the instructions actually do something. Insert the paragraph into another computer and see what it does with the “information.” I think that you will find that even if the complete instructions arose randomly, defying fantastic odds, that it is impossible to use them, without intelligent input. You will need not one miracle but several in order to inform the appropriate parts of the translation mechanism on the meaning and correct use of the words. There is no logical path from the randomly generated “instructions” to actual work without intelligent intervention. Because information is absolutely essential for even the most basic life form there is no logical path to life without the preexistence of an intelligent being.
Now let’s illustrate the problem. We will assume that the basic information is reduced to code. We can take the actual DNA from a living organism to make sure that we get it right. The instructions will look something like this:
AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even “knows” what the code is or the other possible alternatives for coding the information?
In real life the codons are divided by a complicated process that effectively uses the information it correctly gathers from the string of DNA. There really is no code without the accompanying translation machinery that discerns the triplets from the endless string of letters. The machinery must exist before the information can exist. And the string of DNA is useless unless it is correctly translated by preexisting translation machinery. The code is manifest by way of specified enzymes that contain information themselves. This information is coordinated with the string of DNA so that the correct three-letter words are used at the correct time and place. So we must not only have the DNA in the exact order but the enzymes used in translation must be in a specified order to correctly manifest the information. I must also say here that these enzymes (with names like tRNA, rRNA, RNA polymerase etc.) must be of the correct shape. Like a puzzle that fits together these information carrying enzymes fit with the appropriate part in the machinery and transfer the information to another part of the machine that is prepared with the appropriate shape and information content to receive it. The code, the shapes, the information and the logistics necessary to coordinate the process and assemble the fragile parts must exist before life can even begin.
So the miracle of life must begin with a string of miracles in order to communicate the code to all of the parts of the translating machinery and in order to ensure that the correct information is used. As you can see the omission or insertion of even one letter in either the DNA or the translation machinery makes the instructions useless. The code itself came from somewhere? Where? The code was communicated to the appropriate parts of the translation machinery so that it knew what it was translating. Who did this? One miracle is not enough. We must have hundreds of miracles coming together at precise times and places in order to even produce the translation of the code! Of course we still have not created life. We still have not made even one gear in the machinery of life let alone the entire machine itself. Intelligent design is not some far fetched theory devised by a zealous creationist. It is the logical conclusion drawn by the facts and evidence. The alternative is the science fiction of atheists that is based on a string of miracles.
I think that the conclusion to this book is obvious. Regardless of my various points concerning the nature of God or the problems with the theory of evolution or technical errors I may have made in describing the biological complications of a living organism or any other peripheral issues, the absolute fact remains that the foundational problems are insurmountable. It is not possible to produce the necessary complexity or the necessary information contained in basic life without intelligent input. Reasonable people have known this for centuries regardless of their religious affiliation or lack of it. The fanatical atheist cannot see this because he is blind.

